Sample Summary H1Es Summary Track Settings

JavaScript is disabled in your web browser

You must have JavaScript enabled in your web browser to use the Genome Browser

Roadmap Epigenome H1Es Summary for 34 assay type(s)

Track collection: Sample Summary

Description

All tracks in this collection (213)

Display mode: Reset to defaults

Overlay method:
Type of graph:
Track height:	pixels (range: 16 to 64)
Data view scaling:	Always include zero:
Vertical viewing range:	min:	max: (range: 0 to 30)
Transform function:	Transform data points by:
Windowing function:		Smoothing window:	pixels
Negate values:
Draw y indicator lines:	at y = 0.0: at y =

Graph configuration help

All subtracks:

List subtracks: only selected/visible all ()

H1 BS 2a

H1 Cell Line DNA Methylation by Bisulfite-seq Signal from REMC/UCSD (Library:methylC-seq_h1_r2a)

Bisulfite_Conversion_Percentage_Based_On_Mappings:	97.24
GSM:	GSM429321
batch:	#1
biomaterial_provider:	"Thomson Laboratory"
biomaterial_type:	"Cell Line"
bisulfite_conversion_percent:	"99.6% of cytosines converted based on shotgun sequencing of unmethylated lambda phage control spiked into original genomic DNA sample"
bisulfite_conversion_protocol:	"Standard Human Genetic Signatures MethylEasy Xceed bisulfite conversion kit protocol"
dateUnrestricted:	2010-07-13
differentiation_method:	NA
differentiation_stage:	"embryonic stem cell"
disease:	None
dna_preparation_adaptor_ligation_protocol:	"Standard Illumina genomic DNA library preparation ligation protocol (15 minutes at room temperature), except the adapters contained methylcytosine and were supplied by Illumina"
dna_preparation_adaptor_sequence:	A
dna_preparation_fragment_size_range:	"50-500 bp"
dna_preparation_initial_dna_qnty:	"5 µg"
dna_preparation_post-ligation_fragment_size_selection:	"Separation by electrophoresis on a 2% agarose gel followed by excision of 140-210 bp fragments"
experiment_type:	"DNA Methylation"
extraction_protocol:	"Qiagen DNeasy mini kit, performed as per manufacturer's instructions'"
extraction_protocol_sonication_cycles:	"20 cycles of"
extraction_protocol_type_of_sonicator:	"Diagenode Bioruptor"
library_generation_pcr_f_primer_sequence:	"5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT"
library_generation_pcr_number_cycles:	4
library_generation_pcr_polymerase_type:	"Stratagene Pfu Turbo Cx"
library_generation_pcr_primer_conc:	"25 µM"
library_generation_pcr_product_isolation_protocol:	"Separation by electrophoresis on a 2% agarose gel followed by excision of 180-300 bp fragments."
library_generation_pcr_r_primer_sequence:	"5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT"
library_generation_pcr_template_conc:	"One third of the 140-210 nt adapter-ligated, bisulfite converted DNA was used in each 50 µl PCR reaction"
library_generation_pcr_thermocycling_program:	"95˚C 2 min; 98˚C 30 sec, 4 cycles of 98˚C 15 sec, 60˚C 30 sec, 72˚C 4 min; 72˚C 10 min"
line:	H1
lineage:	NA
medium:	TeSR
molecule:	"genomic DNA"
passage:	30
sex:	Male

Data format

H1 DNase 00

UW H1 Cell Line DNase Hypersensitivity Library DS19100 EA Release 7

Data format

H1 DNase 73

UW H1 Cell Line DNase Hypersensitivity Library DS18873 EA Release 7

Data format

H1 H2A.Z Y1

UCSD H1 Cell Line Histone H2A.Z Library AY1 EA Release 8

Data format

H1 H2AK5ac 01

H1 Cell Line H2AK5ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1178 Pcnt=17 Library:SAK201)

Data format

H1 H2AK5ac 97

H1 Cell Line H2AK5ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.2032 Pcnt=33 Library:YL97)

Data format

H1 H2BK120ac 06

H1 Cell Line H2BK120ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.148 Pcnt=33 Library:SAK206)

Data format

H1 H2BK120ac AK146

H1 H2BK120ac Histone Modification by Chip-seq Signal from REMC/UCSD (HOTSPOT_SCORE=0.14 Pcnt=67)

Data format

H1 H2BK120ac SK530

H1 H2BK120ac Histone Modification by Chip-seq Signal from REMC/UCSD (HOTSPOT_SCORE=0.14 Pcnt=67)

Data format

H1 H2BK12ac 03

H1 Cell Line H2BK12ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.202 Pcnt=50 Library:SAK203)

Data format

H1 H2BK12ac 93

H1 Cell Line H2BK12ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1846 Pcnt=25 Library:YL93)

Data format

H1 H2BK15ac 04

H1 Cell Line H2BK15ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1444 Pcnt=40 Library:SAK204)

Data format

H1 H2BK15ac 06

H1 Cell Line H2BK15ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1067 Pcnt=20 Library:YL206)

Data format

H1 H2BK20ac 05

H1 Cell Line H2BK20ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1512 Pcnt=50 Library:SAK205)

Data format

H1 H2BK20ac 07

H1 Cell Line H2BK20ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.121 Pcnt=25 Library:YL207)

Data format

H1 H2BK5ac 02

H1 Cell Line H2BK5ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1906 Pcnt=50 Library:SAK202)

Data format

H1 H2BK5ac 98

H1 Cell Line H2BK5ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.2022 Pcnt=100 Library:YL98)

Data format

H1 H3K18ac 08

H1 Cell Line H3K18ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1969 Pcnt=25 Library:SAK208)

Data format

H1 H3K18ac 21

H1 Cell Line H3K18ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.3196 Pcnt=50 Library:LL321)

Data format

H1 H3K18ac 52

H1 H3K18ac Signal from REMC/UCSD (Hotspot_Score=0.0988 Pcnt=67)

Data format

H1 H3K18ac 58

H1 H3K18ac Signal from REMC/UCSD (Hotspot_Score=0.0893 Pcnt=33)

Data format

H1 H3K23ac 53

H1 H3K23ac Signal from REMC/UCSD (Hotspot_Score=0.0938 Pcnt=75)

Data format

H1 H3K23ac 59

H1 H3K23ac Signal from REMC/UCSD (Hotspot_Score=0.0796 Pcnt=25)

Data format

H1 H3K23me2 10

H1 Cell Line H3K23me2 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.3013 Pcnt=100 Library:SAK210)

Data format

H1 H3K23me2 98

H1 Cell Line H3K23me2 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.091 Pcnt=50 Library:YL198)

Data format

H1 H3K27ac 13

H1 Cell Line H3K27ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.3968 Pcnt=50 Library:LL313)

Data format

H1 H3K27ac 70

H1 H3K27ac Signal from REMC/UCSD (Hotspot_Score=0.2837 Pcnt=100)

Data format

H1 H3K27me3 14

H1 Cell Line H3K27me3 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.497 Pcnt=100 Library:LL314)

Data format

H1 H3K27me3 23

H1 H3K27me3 Histone Modification by Chip-seq Signal from REMC/Broad (Hotspot_Score=0.3386 Pcnt=87 Library:Solexa-12523)

Data format

H1 H3K27me3 39

H1 H3K27me3 Histone Modification by Chip-seq Signal from REMC/Broad (Hotspot_Score=0.2783 Pcnt=71 DonorID:Solexa-8039)

Data format

H1 H3K27me3 41

H1 Cell Line H3K27me3 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.3607 Pcnt=88 Library:LL241)

Data format

H1 H3K27me3 95

H1 Cell Line H3K27me3 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.3196 Pcnt=85 Library:YL95)

Data format

H1 H3K27me3 A

H1 Cell Line H3K27me3 Histone Modification by Chip-seq Signal from REMC/UCSF (Hotspot_Score=0.2469 Pcnt=58 DonorID:NA)

Data format

H1 H3K36me3 20

H1 Cell Line H3K36me3 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.3294 Pcnt=75 Library:LL220)

Data format

H1 H3K36me3 24

H1 H3K36me3 Histone Modification by Chip-seq Signal from REMC/Broad (Hotspot_Score=0.1645 Pcnt=19 DonorID:Solexa-12524)

Data format

H1 H3K36me3 60

H1 Cell Line H3K36me3 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.4284 Pcnt=91 Library:LL160)

Data format

H1 H3K36me3 61

H1 H3K36me3 Histone Modification by Chip-seq Signal from REMC/Broad (Hotspot_Score=0.0 Pcnt=NA Library:Solexa-14961)

Data format

H1 H3K36me3 70

H1 Cell Line H3K36me3 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.2825 Pcnt=58 Library:SAK70)

Data format

H1 H3K36me3 A

H1 Cell Line H3K36me3 Histone Modification by Chip-seq Signal from REMC/UCSF (Hotspot_Score=0.245 Pcnt=45 DonorID:NA)

Data format

H1 H3K36me3 B

H1 Cell Line H3K36me3 Histone Modification by Chip-seq Signal from REMC/UCSF (Hotspot_Score=0.3604 Pcnt=79 DonorID:NA)

Data format

H1 H3K4ac 07

H1 Cell Line H3K4ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1755 Pcnt=33 Library:SAK207)

Data format

H1 H3K4ac 51

H1 H3K4ac Signal from REMC/UCSD (Hotspot_Score=0.0655 Pcnt=50)

Data format

H1 H3K4me1 11

H1 Cell Line H3K4me1 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.34 Pcnt=33 Library:LL311)

Data format

H1 H3K4me1 28

H1 Cell Line H3K4me1 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1997 Pcnt=12 Library:LL228)

Data format

H1 H3K4me1 29

H1 H3K4me1 Histone Modification by Chip-seq Signal from REMC/Broad (Hotspot_Score=0.2785 Pcnt=21 Library:Solexa-10529)

Data format

H1 H3K4me1 31

H1 Cell Line H3K4me1 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.3905 Pcnt=58 Library:YL131)

Data format

H1 H3K4me1 61

H1 H3K4me1 Histone Modification by Chip-seq Signal from REMC/Broad (Hotspot_Score=0.2723 Pcnt=19 Library:Solexa-13061)

Data format

H1 H3K4me1 D

H1 Cell Line H3K4me1 Histone Modification by Chip-seq Signal from REMC/UCSF (Hotspot_Score=0.3605 Pcnt=42 DonorID:NA)

Data format

H1 H3K4me2 22

H1 Cell Line H3K4me2 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.6394 Pcnt=75 Library:LL322)

Data format

H1 H3K4me2 96

H1 Cell Line H3K4me2 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.5517 Pcnt=50 Library:YL96)

Data format

H1 H3K4me3 12

H1 Cell Line H3K4me3 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.6914 Pcnt=92 Library:LL312)

Data format

H1 H3K4me3 22

H1 H3K4me3 Histone Modification by Chip-seq Signal from REMC/Broad (Hotspot_Score=0.2734 Pcnt=23 Library:Solexa-12522)

Data format

H1 H3K4me3 27

H1 Cell Line H3K4me3 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.6545 Pcnt=87 Library:LL227)

Data format

H1 H3K4me3 38

H1 H3K4me3 Histone Modification by Chip-seq Signal from REMC/Broad (Hotspot_Score=0.4388 Pcnt=61 Library:Solexa-8038)

Data format

H1 H3K4me3 67

H1 Cell Line H3K4me3 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.6969 Pcnt=93 Library:SAK67)

Data format

H1 H3K4me3 98

H1 H3K4me3 Histone Modification by Chip-seq Signal from REMC/Broad (Hotspot_Score=0.3314 Pcnt=36 Library:Solexa-10398)

Data format

H1 H3K4me3 A

H1 Cell Line H3K4me3 Histone Modification by Chip-seq Signal from REMC/UCSF (Hotspot_Score=0.5868 Pcnt=82 DonorID:NA)

Data format

H1 H3K4me3 C

H1 Cell Line H3K4me3 Histone Modification by Chip-seq Signal from REMC/UCSF (Hotspot_Score=0.7097 Pcnt=95 DonorID:NA)

Data format

H1 H3K56ac 00

H1 H3K56ac Signal from REMC/UCSD (Hotspot_Score=0.0979 Pcnt=50)

Data format

H1 H3K56ac 11

H1 Cell Line H3K56ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.231 Pcnt=33 Library:SAK211)

Data format

H1 H3K79me1 73

H1 Cell Line H3K79me1 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1751 Pcnt=29 Library:SAK73)

Data format

H1 H3K79me1 82

H1 Cell Line H3K79me1 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1822 Pcnt=43 Library:YL82)

Data format

H1 H3K79me1 92

H1 Cell Line H3K79me1 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.123 Pcnt=14 Library:YL192)

Data format

H1 H3K79me2 04

H1 Cell Line H3K79me2 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1514 Pcnt=50 Library:YL204)

Data format

H1 H3K79me2 80

H1 Cell Line H3K79me2 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1512 Pcnt=25 Library:SAK80)

Data format

H1 H3K9ac 26

H1 H3K9ac Histone Modification by Chip-seq Signal from REMC/Broad (Hotspot_Score=0.2242 Pcnt=40 Library:Solexa-12526)

Data format

H1 H3K9ac 40

H1 Cell Line H3K9ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.2413 Pcnt=51 Library:LL240)

Data format

H1 H3K9ac 62

H1 H3K9ac Histone Modification by Chip-seq Signal from REMC/Broad (Hotspot_Score=0.1796 Pcnt=34 Library:Solexa-14962)

Data format

H1 H3K9ac 68

H1 Cell Line H3K9ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.241 Pcnt=49 Library:SAK68)

Data format

H1 H3K9ac A

H1 Cell Line H3K9ac Histone Modification by Chip-seq Signal from REMC/UCSF (Hotspot_Score=0.2077 Pcnt=37 DonorID:NA)

Data format

H1 H3K9me3 18

H1 Cell Line H3K9me3 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.4557 Pcnt=NA Library:LL218)

Data format

H1 H3K9me3 25

H1 H3K9me3 Histone Modification by Chip-seq Signal from REMC/Broad (Hotspot_Score=0.1525 Pcnt=46 Library:Solexa-12525)

Data format

H1 H3K9me3 54

UCSD H1 Cell Line Histone H3K9me3 Library AK54 EA Release 6

Data format

H1 H3K9me3 75

H1 Cell Line H3K9me3 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1788 Pcnt=56 Library:YL75)

Data format

H1 H3K9me3 77

H1 Cell Line H3K9me3 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.2029 Pcnt=68 Library:YL77)

Data format

H1 H3K9me3 A

H1 Cell Line H3K9me3 Histone Modification by Chip-seq Signal from REMC/UCSF (Hotspot_Score=0.2167 Pcnt=73 DonorID:NA)

Data format

H1 H3K9me3 B

H1 Cell Line H3K9me3 Histone Modification by Chip-seq Signal from REMC/UCSF (Hotspot_Score=0.3856 Pcnt=97 DonorID:NA)

Data format

H1 H4K20me1 53

H1 Cell Line H4K20me1 Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1863 Pcnt=33 Library:YL253)

Data format

H1 H4K20me1 SK529

H1 H4K20me1 Histone Modification by Chip-seq Signal from REMC/UCSD (HOTSPOT_SCORE=0.19 Pcnt=100)

Data format

H1 H4K5ac 23

H1 Cell Line H4K5ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.3499 Pcnt=NA Library:LL323)

Data format

H1 H4K5ac SK302

H1 H4K5ac Histone Modification by Chip-seq Signal from REMC/UCSD (HOTSPOT_SCORE=0.12 Pcnt=100)

Data format

H1 H4K8ac 17

UCSD H1 Cell Line Histone H4K8ac Library AY17 EA Release 8

Data format

H1 H4K8ac 18

UCSD H1 Cell Line Histone H4K8ac Library AY18 EA Release 8

Data format

H1 H4K91ac 54

H1 Cell Line H4K91ac Histone Modification by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1945 Pcnt=33 Library:YL254)

Data format

H1 H4K91ac SK303

H1 H4K91ac Histone Modification by Chip-seq Signal from REMC/UCSD (HOTSPOT_SCORE=0.15 Pcnt=100)

Data format

H1 Input 08

H1 Histone Modification Input by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.083 Pcnt=65 Library:YL208)

Data format

H1 Input 19

H1 Histone Modification Input by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1569 Pcnt=83 Library:DM219)

Data format

H1 Input 1U

H1 Histone Modification Input by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.187 Pcnt=88 Library:LLH1U)

Data format

H1 Input 2

H1 Cell Line Input Histone Modification by Chip-seq Signal from REMC/UCSF (Hotspot_Score=0.1575 Pcnt=85 DonorID:NA)

Data format

H1 Input 28

H1 Input Signal from REMC/UCSD (Hotspot_Score=0.2124 Pcnt=97)

Data format

H1 Input 31

H1 Input Histone Modification by Chip-seq Signal from REMC/Broad (Hotspot_Score=0.0894 Pcnt=73 Library:Solexa-10531)

Data format

H1 Input 32

H1 Input Histone Modification by Chip-seq Signal from REMC/Broad (Hotspot_Score=0.0809 Pcnt=61 Library:Solexa-12532)

Data format

H1 Input 54

H1 Histone Modification Input by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1195 Pcnt=79 Library:YL154)

Data format

H1 Input 57

H1 Input Signal from REMC/UCSD (Hotspot_Score=0.0846 Pcnt=93)

Data format

H1 Input 62

H1 Histone Modification Input by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.0803 Pcnt=59 Library:YL262)

Data format

H1 Input d1

H1 Cell Line Input Histone Modification by Chip-seq Signal from REMC/UCSF (Hotspot_Score=0.033 Pcnt=42 DonorID:NA)

Data format

H1 Input I1

H1 Histone Modification Input by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1133 Pcnt=77 Library:LL-H1-I1)

Data format

H1 Input I2

H1 Histone Modification Input by Chip-seq Signal from REMC/UCSD (Hotspot_Score=0.1532 Pcnt=82 Library:LL-H1-I2)

Data format

H1 MeDIP 03

H1 Cell Line DNA Methylation by MeDIP-seq Signal from REMC/UCSF-UBC (Hotspot_Score=0.3021 Pcnt=37 Library:JOC13)

Data format

H1 MeDIP 76

H1 Cell Line DNA Methylation by MeDIP-seq Signal from REMC/UCSF-UBC (Hotspot_Score=0.3687 Pcnt=62 Library:HS1376)

Data format

H1 MRE 52

H1 Cell Line DNA Methylation by MRE-seq Signal from REMC/UCSF-UBC (DonorID:NA)

Data format

H1 MRE 53

H1 Cell Line DNA Methylation by MRE-seq Signal from REMC/UCSF-UBC (DonorID:NA)

Data format

H1 MRE 73

H1 Cell Line DNA Methylation by MRE-seq Signal from REMC/UCSF-UBC (Library:HS1473)

Data format

H1 mRNA 1a

UCSD H1 Cell Line mRNA-Seq Library polyA-RNA-seq_h1_r1a EA Release 8

GEO_Accession:	"GSM915328"
Sex:	Male
batch:	"Replicate 1"
biomaterial_provider:	"Thomson Laboratory"
biomaterial_type:	"Cell Line"
cdna_preparation_first_strand_purification:	"Purification with RNAClean XP beads (Agencourt)"
cdna_preparation_first_strand_synthesis_enzyme:	"SuperScript III (Invitrogen)"
cdna_preparation_fragment_size_range:	200-250
cdna_preparation_fragmentation:	"PolyA RNA resuspended in 2x Superscript III buffer supplemented with 10 mM DTT was incubated at 94°C for 4 min"
cdna_preparation_initial_rna_qnty:	"4 µg"
cdna_preparation_polya_rna/:	"Dynabeads oligo(dt)25 (Invitrogen)"
cdna_preparation_purification:	"Purification with AMPure XP beads (Agencourt)"
cdna_preparation_second_strand_synthesis_dntp_mix:	"dNTP mix made from 10 mM dATP, dCTP, dGTP, dUTP"
cdna_preparation_second_strand_synthesis_enzyme:	"DNA Polymerase I (E. coli) (New England Biolabs)"
dateUnrestricted:	2013-01-18
differentiation_method:	"H1 cells were cultured on plates coated with fibronectin and human collagen"
differentiation_stage:	"embryonic stem cell differentiated by treatment with fibronectin and human collagen"
disease:	None
dna_preparation_adaptor:	"TruSeq Multiplexed Adapters (Illumina)"
dna_preparation_adaptor_ligation_protocol:	"16°C for 16 hours with T4 DNA ligase (New England Biolabs)"
dna_preparation_post-ligation_fragment_size_selection:	"Two rounds of purification with AMPure XP beads (Agencourt)"
dna_preparation_uracil_dna_glycosylase_digestion:	"One half of adapter-ligated cDNA digested with uracil DNA glycosylase (Enzymatics) and used for subsequent steps."
experiment_type:	mRNA-Seq
extraction_protocol:	"Qiagen RNeasy mini kit, performed as per manufacturer's instructions"
extraction_protocol_mrna_enrichment:	"Dynabeads oligo(dt)25 protocol"
library_generation_pcr_f_primer_sequence:	"5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC 3'"
library_generation_pcr_number_cycles:	10
library_generation_pcr_polymerase_type:	"TruSeq PCR Master Mix (Illumina)"
library_generation_pcr_primer:	"TruSeq PCR Primer Cocktail (Illumina)"
library_generation_pcr_primer_conc:	200nM
library_generation_pcr_product_isolation_protocol:	"Purification with AMPure XP beads (Agencourt)"
library_generation_pcr_r_primer_sequence:	"5' CAAGCAGAAGACGGCATACGAGAT 3'"
library_generation_pcr_template:	cDNA
library_generation_pcr_template_conc:	"5 ng/µL"
library_generation_pcr_thermocycling_program:	"98°C 30 sec, 10 cycles of 98°C 10 sec, 60°C 30 sec, 72°C 30 sec, 72°C 10 min"
line:	H1
lineage:	NA
medium:	"50% StemLine II serum-free HSC expansion medium (HSFEM, Sigma), 50% ESFM, GlutaMAX (1/100 dilution), Ex-Cyte supplement (1/2000 dilution), 100 mM MTG, and 10 ng/ml FGF2."
passage:	5
rna_preparation_reverse_transcription_primer_sequence:	"Random hexamers"
rna_preparation_reverse_transcription_protocol:	"First-strand Superscript III (Invitrogen) RT protocol. RNAClean XP purification of first strand product. Second-strand synthesis using dUTP-containing dNTPS and DNA Polymerase 1 (E. coli) (New England Biolabs)"
sample_alias:	H1_RNA_r1
sample_common_name:	"H1 Cell Line"

Data format

H1 mRNA 2a

UCSD H1 Cell Line mRNA-Seq Library polyA-RNA-seq_h1_r2a EA Release 8

GEO_Accession:	"GSM915329"
Sex:	Male
batch:	"Replicate 2"
biomaterial_provider:	"Thomson Laboratory"
biomaterial_type:	"Cell Line"
cdna_preparation_first_strand_purification:	"Purification with RNAClean XP beads (Agencourt)"
cdna_preparation_first_strand_synthesis_enzyme:	"SuperScript III (Invitrogen)"
cdna_preparation_fragment_size_range:	200-250
cdna_preparation_fragmentation:	"PolyA RNA resuspended in 2x Superscript III buffer supplemented with 10 mM DTT was incubated at 94°C for 4 min"
cdna_preparation_initial_rna_qnty:	"4 µg"
cdna_preparation_polya_rna/:	"Dynabeads oligo(dt)25 (Invitrogen)"
cdna_preparation_purification:	"Purification with AMPure XP beads (Agencourt)"
cdna_preparation_second_strand_synthesis_dntp_mix:	"dNTP mix made from 10 mM dATP, dCTP, dGTP, dUTP"
cdna_preparation_second_strand_synthesis_enzyme:	"DNA Polymerase I (E. coli) (New England Biolabs)"
dateUnrestricted:	2013-01-18
differentiation_method:	"H1 cells were cultured on plates coated with fibronectin and human collagen"
differentiation_stage:	"embryonic stem cell differentiated by treatment with fibronectin and human collagen"
disease:	None
dna_preparation_adaptor:	"TruSeq Multiplexed Adapters (Illumina)"
dna_preparation_adaptor_ligation_protocol:	"16°C for 16 hours with T4 DNA ligase (New England Biolabs)"
dna_preparation_post-ligation_fragment_size_selection:	"Two rounds of purification with AMPure XP beads (Agencourt)"
dna_preparation_uracil_dna_glycosylase_digestion:	"One half of adapter-ligated cDNA digested with uracil DNA glycosylase (Enzymatics) and used for subsequent steps."
experiment_type:	mRNA-Seq
extraction_protocol:	"Qiagen RNeasy mini kit, performed as per manufacturer's instructions"
extraction_protocol_mrna_enrichment:	"Dynabeads oligo(dt)25 protocol"
library_generation_pcr_f_primer_sequence:	"5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC 3'"
library_generation_pcr_number_cycles:	10
library_generation_pcr_polymerase_type:	"TruSeq PCR Master Mix (Illumina)"
library_generation_pcr_primer:	"TruSeq PCR Primer Cocktail (Illumina)"
library_generation_pcr_primer_conc:	200nM
library_generation_pcr_product_isolation_protocol:	"Purification with AMPure XP beads (Agencourt)"
library_generation_pcr_r_primer_sequence:	"5' CAAGCAGAAGACGGCATACGAGAT 3'"
library_generation_pcr_template:	cDNA
library_generation_pcr_template_conc:	"5 ng/µL"
library_generation_pcr_thermocycling_program:	"98°C 30 sec, 10 cycles of 98°C 10 sec, 60°C 30 sec, 72°C 30 sec, 72°C 10 min"
line:	H1
lineage:	NA
medium:	"50% StemLine II serum-free HSC expansion medium (HSFEM, Sigma), 50% ESFM, GlutaMAX (1/100 dilution), Ex-Cyte supplement (1/2000 dilution), 100 mM MTG, and 10 ng/ml FGF2."
passage:	5
rna_preparation_reverse_transcription_primer_sequence:	"Random hexamers"
rna_preparation_reverse_transcription_protocol:	"First-strand Superscript III (Invitrogen) RT protocol. RNAClean XP purification of first strand product. Second-strand synthesis using dUTP-containing dNTPS and DNA Polymerase 1 (E. coli) (New England Biolabs)"
sample_alias:	H1_RNA_r2
sample_common_name:	"H1 Cell Line"

Data format

H1 mRNA l2

H1 Cell Line mRNA-seq Signal from REMC/UCSF-UBC (DonorID:H1EScd1 batch2 vial2)

Data format

H1 RRBS 34

H1 Cell Line DNA Methylation by RRBS Signal from REMC/Broad (Library:RRBS534/RRBS535)

Data format

H1 RRBS 60

H1 Cell Line DNA Methylation by RRBS Signal from REMC/Broad (Library:Solexa-13232/Solexa-13233)

Data format

H1 RRBS 76

H1 Cell Line DNA Methylation by RRBS Signal from REMC/Broad (Library:RRBS776/RRBS777/RRBS778/RRBS779)

Data format

H1 RRBS 77

H1 Cell Line DNA Methylation by RRBS Signal from REMC/Broad (Library:RRBS677/RRBS678)

Data format

H1 smRNA l1

H1 Cell Line smRNA-seq Signal from REMC/UCSF-UBC (DonorID:H1EScd1 batch2 vial1)

GSM:	GSM450239
Sex:	Male
batch:	#2
biomaterial_provider:	"Cellular Dynamics International"
biomaterial_type:	"Cell Line"
dateUnrestricted:	2010-10-07
differentiation_method:	NA
differentiation_stage:	undifferentiated
disease:	None
experiment_type:	smRNA-Seq
extraction_protocol:	"Total RNA was extracted using Trizol from Invitrogen as per manufacturer's instuctions."
extraction_protocol_smrna_enrichment:	"The small RNA fraction was separated by electrophoresis on a Novex 10% TBE-Urea gel and the fraction between approximately 14-30nt was excised. The excisd fraction was then eluted from gel fragements, followed by EtOH precipitation and was resuspended in 6.3ul."
library_generation_pcr_f_primer_sequence:	"5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA 3'"
library_generation_pcr_number_cycles:	15
library_generation_pcr_polymerase_type:	"Phusion DNA Polymerase (Hot Start), 2U/ul (from NEB)"
library_generation_pcr_primer_conc:	0.25uM
library_generation_pcr_product_isolation_protocol:	"PCR product was separated by electrophoresis on 8% TBE Novex Gel and the PCR product between 92-125bp was excised. Product was then eluted from gel fragements, followed by EtOH precipitation"
library_generation_pcr_r_primer_sequence:	"5' CAAGCAGAAGACGGCATACGA 3'"
library_generation_pcr_template:	"10ul of the first strand cDNA product was used in the PCR"
library_generation_pcr_thermocycling_program:	"98°C for 30sec; 98°C for 10sec, 60°C for 30sec, 72°C for 15sec for 15 cycles; 72°C for 5min"
line:	"H1 (WA01)"
lineage:	NA
medium:	NA
passage:	NA
rna_preparation_3'_rna_adapter_ligation_protocol:	"3' RNA adapter ligation was set up with 6.3ul of purified 5' ligation product, 1.2ul of 10uM 3' RNA adapter, 1ul of 10x Ligation buffer, 1ul of T4 RNA Ligase (5U/ul from Ambion)), and 0.5ul of Rnase OUT (40U/ul from Invitrogen). The ligation reaction was incubated at 16oC overnight."
rna_preparation_3'_rna_adapter_sequence:	"5' pUCGUAUGCCGUCUUCUGCUUGidT 3' (p=phosphate, idT=inverted deoxythyidine)"
rna_preparation_5'_rna_adapter_ligation_protocol:	"5' RNA adapter ligation was set up with 6.2ul of purified small RNA fraction (14-30nt), 1.3ul of 5uM 5' RNA adapter, 1ul of 10x Ligation buffer, 1ul of T4 RNA Ligase (5U/ul from Ambion), and 0.5ul of Rnase OUT (40U/ul from Invitrogen). Ligation reaction was incubated at 16oC overnight."
rna_preparation_5'_rna_adapter_sequence:	"5' GUUCAGAGUUCUACAGUCCGACGAUC 3'"
rna_preparation_reverse_transcription_primer_sequence:	"5' CAAGCAGAAGACGGCATACGA 3'"
rna_preparation_reverse_transcription_protocol:	"To 4.5ul of purified ligated RNA, 0.5ul of 100uM Small RNA RT-Primer was added and heat denatured at 70oC for 2 mins. Sample was then placed on a rack at room temperature and the following reagents were added immediately to the sample (2.0ul of 5X First Strand Buffer, 0.65ul of 10mM dNTPs (Invitrogen), 1ul of 100mM DTT (Invitrogen) and 0.5ul of RNaseOUT (40U/ul from Invitrogen). Reaction was heated at 48oC for 3mins. 1.0ul of Superscript II RT (200U/ul from Invitrogen) was added to the reaction and was incubated at 44oC for 1 hr. After 1hr of incubation, tube was placed on ice. 12ul of DEPC water was added to the first strand cDNA product to make a final total volume of approximately 20ul."
smrna_preparation_initial_smrna_qnty:	"10000 ng"

Data format

Assembly: Human Feb. 2009 (GRCh37/hg19)

Vizhub @ Wash U built this track, and Roadmap Epigenomics Consortium is responsible for its contents.

Description

These tracks are genome-wide DNA methylation maps generated by Roadmap Epigenomics Project. Each track is collection of DNA methylation experiment data on one sample type.

DNA methylation of human DNA mostly happens on cytosine bases of CpG dinucleotides. The methylated DNA usually prevent accessibility of regulatory proteins and hampers transcription, while unmethylated DNA is usually indicative of open chromatin. The MeDIP-Seq and MRE-Seq experiments are usually performed on same sample to identify genome-wide DNA methylation pattern. MeDIP-Seq (methylated DNA immunoprecipitation and sequencing) is a ChIP-based approach utilizing antibody against methylated cytosine. This method enriches methylated DNA and high read count indicates high likelihood of underlying region is methylated. The MRE-Seq (methylation restriction enzyme sequencing) uses methylation-sensitive restriction enzymes to digest DNA, and only cut at unmethylated restriction sites. The cut restriction sites will be detected by sequencing where reads aligned to a restriction site on reference genome means the restriction site is unmethylated.

The MethylC-Seq (MethylC sequencing) uses bisulfite to convert methylated cytosines to thymines before sequencing. The percentage of reads with a T versus a C indicates the percentage methylation at the cytosine. Details can be found in this paper Lister R, et al., Nature. 2009 Nov 19;462(7271):315-22. .

RRBS (Reduced-Representation-Bisulfite-Sequencing) is similar to MethylC-seq except RRBS uses restriction enzyme to fragment the genome into fragments suitably-sized for sequencing. While RRBS produces percent methylation similar to MethylC-seq, it is limited to cytosines that are within restriction fragments of a suitable size and tend to measure CpG dense regions only. Details can be found in this paper: Meissener, A. et al., Nucleic Acids Res. 2005; 33(18): 5868-5877. .

Display conventions

Each track can be turned on/off individually. Inside each track, sub-tracks are displayed in same vertical space and are overlayed with transparent colors for contrast. All tracks displays read density data in form of wiggle plots. Number of aligned reads is counted at each base pair, and a summarized value is computed for each 20 bp interval for display. Sub-tracks sharing same space use same scale.

Methods

Experimental protocols: follow this link for experimental protocols.

Data processing: EDACC carried out data processing and quality assessment. Details are fully explained here . In brief, sequencing reads were aligned with 'Pash' program to derive read density data. The read density data is prepared into 'wiggle' format files with fixed step length of 20 bp. Data in wiggle and other formats have been deposited in NCBI Gene Expression Omnibus database for public access.

Quality control: the HotSpot was one of the methods used to assess quality of MeDIP-Seq experiments. The long track name includes a "Hotspot_Score" field indicates the percentage of sequencing reads found inside hotspot regions. The "Pcnt" field shows the percentile of current experiment score in all MeDIP-Seq experiments. This value is subject to change in next Data Release. The most comprehensive and up-to-date description on QC Metrics used by the consortium can be found here .

Release Notes

The data is combination of Release II, III, IV, V, VI, VII, VIII and IX which were mapped to human reference genome version hg19. The data is production of Roadmap Epigenomics Project.

Please follow the link for Roadmap Epigenomics data access policy

Credits

These data were generated in labs from three institutions: UCSF, UBC, UCSD as part of Roadmap Epigenomics Project.

Useful links

Roadmap Consortium project home page
NCBI Epigenomics Gateway portal to all project data in GEO database
Epigenome Data and Analysis Coordination Center/EDACC